lvl0 turboRFP CDS
(Plasmid #153392)

• Purpose: Red fluorescent protein coding sequence
• Depositing Lab: Naomi Nakayama
• Publication: Andreou et al bioRxiv, March 31, 2021

Backbone

• Vector backbone: mUAV
• Backbone size w/o insert (bp): 2053
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: turboRFP CDS
• Species: Synthetic
• Insert Size (bp): 701

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AarI (destroyed during cloning)
• 3′ cloning site: AarI (destroyed during cloning)
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • lvl0 turboRFP CDS.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry