Skip to main content

lvl0 mKate2 CDS
(Plasmid #153394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153394 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mUAV
  • Backbone size w/o insert (bp) 2053
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2 CDS
  • Species
    Synthetic
  • Insert Size (bp)
    725
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AarI (destroyed during cloning)
  • 3′ cloning site AarI (destroyed during cloning)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lvl0 mKate2 CDS was a gift from Naomi Nakayama (Addgene plasmid # 153394 ; http://n2t.net/addgene:153394 ; RRID:Addgene_153394)
  • For your References section:

    Mobius Assembly for Plant Systems highlights promoter-terminator interaction in gene regulation. Andreou , Andreas I., Nirkko, Jessica , Ochoa-Villarreal, Marisol , Nakayama, Naomi. bioRxiv, March 31, 2021 10.1101/2021.03.31.437819