pETCON-Aga2p-TAPBPR-myc
(Plasmid
#153486)
-
PurposeYeast expression of Aga2p-TAPBPR-myc
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETCON
- Backbone size w/o insert (bp) 6287
- Total vector size (bp) 7439
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAPBPR
-
Alt nameTAPBPL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1152
-
GenBank IDBC015017
-
Entrez GeneTAPBPL (a.k.a. TAPBP-R, TAPBPR)
- Promoter GAL
-
Tags
/ Fusion Proteins
- Aga2P (N terminal on insert)
- c-myc epitope tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer None
- 3′ sequencing primer cgagctaaaagtacagtggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETCON-Aga2p-TAPBPR-myc was a gift from Erik Procko (Addgene plasmid # 153486 ; http://n2t.net/addgene:153486 ; RRID:Addgene_153486) -
For your References section:
TAPBPR promotes antigen loading on MHC-I molecules using a peptide trap. McShan AC, Devlin CA, Morozov GI, Overall SA, Moschidi D, Akella N, Procko E, Sgourakis NG. Nat Commun. 2021 May 26;12(1):3174. doi: 10.1038/s41467-021-23225-6. 10.1038/s41467-021-23225-6 PubMed 34039964