Skip to main content

pSb_init containing anti SARS-CoV-2_RBD sybody Sb#14
(Plasmid #153522)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153522 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB_init
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sb#14
  • Species
    Synthetic
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (unknown if destroyed)
  • 3′ cloning site BspQI (unknown if destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSb_init containing anti SARS-CoV-2_RBD sybody Sb#14 was a gift from Markus Seeger (Addgene plasmid # 153522 ; http://n2t.net/addgene:153522 ; RRID:Addgene_153522)
  • For your References section:

    Synthetic nanobodies targeting the SARS-CoV-2 receptor-binding domain. Walter JD, Hutter CAJ, Zimmermann I, Earp JD, Egloff P, Sorgenfrei M, Hürlimann LM, Gonda I, Meier G, Remm S, Thavarasah S, Plattet P, Seeger MA. bioRxiv 2020.04.16.045419 10.1101/2020.04.16.045419