SNAP-Dcp2
(Plasmid
#153975)
-
PurposeSNAP-tag polypeptide fused to mRNA decapping enzyme 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACGFP-c1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5787
-
Modifications to backboneGFP replaced with SNAP tag using NheI and BspEI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRNA Decapping enzyme 2
-
Alt nameDcp2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1260
-
Entrez GeneDCP2 (a.k.a. NUDT20)
-
Tag
/ Fusion Protein
- SNAP-C1 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGTGCAGGGCGACCTGGACG
- 3′ sequencing primer GGTGTGGGAGGTTTTTTAAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP-Dcp2 was a gift from Ross Buchan.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We amplified GFP-Dcp2 to obtain SNAP-Dcp2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SNAP-Dcp2 was a gift from Gia Voeltz (Addgene plasmid # 153975 ; http://n2t.net/addgene:153975 ; RRID:Addgene_153975) -
For your References section:
Endoplasmic reticulum contact sites regulate the dynamics of membraneless organelles. Lee JE, Cathey PI, Wu H, Parker R, Voeltz GK. Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108. 10.1126/science.aay7108 PubMed 32001628