pZmUbi-5'UTR
(Plasmid
#154057)
-
PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUAP1
- Backbone size w/o insert (bp) 3138
- Total vector size (bp) 4049
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter and 5' UTR Ubiquitin (Zea mays)
-
Alt namepZmUbi + 5' UTR
-
Insert Size (bp)1987
- Promoter N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer CCTGCAGAAGTAACACCAAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe ZmUbi promoter and 5' UTR sequence is derived from the pICSL12009 plasmid, developed by Nicola Patron.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZmUbi-5'UTR was a gift from Cristobal Uauy (Addgene plasmid # 154057 ; http://n2t.net/addgene:154057 ; RRID:Addgene_154057) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173