EC10161
(Plasmid
#154060)
-
Purpose(Empty Backbone) Level 0.5 Golden Gate backbone, containing loxP sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
-
Backbone manufacturerNA
- Backbone size (bp) 3103
-
Modifications to backboneAddition of LoxP sites flanking the lacZ reporter gene.
-
Vector typeBacterial Expression, Cre/Lox, Synthetic Biology
- Promoter N/A
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tgcacgtctcatactgacct
- 3′ sequencing primer gcgtctcacattcaaccctt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byEngineering Nitrogen Symbiosis for Africa (ENSA)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EC10161 was a gift from Cristobal Uauy (Addgene plasmid # 154060 ; http://n2t.net/addgene:154060 ; RRID:Addgene_154060) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173