Skip to main content
Addgene

EC10161
(Plasmid #154060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    NA
  • Backbone manufacturer
    NA
  • Backbone size (bp) 3103
  • Modifications to backbone
    Addition of LoxP sites flanking the lacZ reporter gene.
  • Vector type
    Bacterial Expression, Cre/Lox, Synthetic Biology
  • Promoter N/A

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tgcacgtctcatactgacct
  • 3′ sequencing primer gcgtctcacattcaaccctt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Engineering Nitrogen Symbiosis for Africa (ENSA)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EC10161 was a gift from Cristobal Uauy (Addgene plasmid # 154060 ; http://n2t.net/addgene:154060 ; RRID:Addgene_154060)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173