Skip to main content

HS_NAM-B1
(Plasmid #154064)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154064 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM8031
  • Backbone manufacturer
    Sylvestre Marillonnet/TSL SynBio
  • Backbone size w/o insert (bp) 4604
  • Total vector size (bp) 15906
  • Vector type
    Bacterial Expression, Plant Expression, Cre/Lox, Synthetic Biology ; Golden Gate
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Hygromycin phosphotransferase
  • Alt name
    HPTI
  • Insert Size (bp)
    2901
  • GenBank ID
    AET79511.1
  • Promoter OsAct

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer agtggtgattttgtgccgag
  • 3′ sequencing primer gttggatctcttctgcagca
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cre recombinase
  • Alt name
    Cre-U5-Cre
  • Species
    Escherichia virus P1
  • Insert Size (bp)
    2133
  • GenBank ID
    2777477
  • Promoter HvHSP17

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer TGACCTCGAGTATGCTAGCG
  • 3′ sequencing primer TCTAGAGAGGGGCACGAC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    LoxP-flanked GUS and TtNAM-B1
  • Alt name
    ZmUbi::loxP-GUS-nosT-loxP-NAM-B1-nosT
  • Species
    Triticum turgidum ssp. dicoccoides (NAM-B1) and Escherichia coli (GUS)
  • Insert Size (bp)
    6169
  • Mutation
    The TtNAM-B1 gene sequence was domesticated to remove any BbsI or BsaI sites. One BbsI site was identified and was domesticated from “GTCTTC” to “ATCGTC”, removing the enzyme cut site but retaining the correct amino acid sequence. The exonic sequence is based on the sequence of NAM-B1 from T. turgidum ssp. dicoccoides, while the intronic sequence is taken from the non-functional copy of NAM-B1 present in Chinese Spring.
  • Promoter ZmUbi

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer atcccttgcgaacctcatca
  • 3′ sequencing primer acccgccaatatatcctgtca
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The promoter sequence and 5' UTR are derived from pICSL12009, the GUS coding sequence is derived from pICH7511, both shared by Nicola Patron. The LoxP sites are derived from the ENSA construct EC10161. The selection casette (OsAct::HPTI) was shared by the BRACT group at JIC, published in Rey et al. 2018, Front. Plant Sci.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HS_NAM-B1 was a gift from Cristobal Uauy (Addgene plasmid # 154064 ; http://n2t.net/addgene:154064 ; RRID:Addgene_154064)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173