EC71167
(Plasmid
#154066)
-
PurposeLevel 1 Position 3 Golden Gate vector, pL1M-R3-UbqP-Loxp-ER-Targ-mCherry-HDEL-Loxp-eGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEC47822
-
Backbone manufacturerENSA
- Backbone size w/o insert (bp) 4376
- Total vector size (bp) 8790
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZmUBI::lox-mCHERRY-lox-T35S-eGFP-TAct
-
Alt nameLox bound mCHERRY
-
SpeciesA. thaliana (mustard weed), Synthetic; Zea mays
-
Insert Size (bp)4414
-
MutationAll BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes
- Promoter Zea mays Ubiquitin Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GCACATACAAATGGACGAAC
- 3′ sequencing primer CTGCCTGTATCGAGTGGTGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EC71167 was a gift from Cristobal Uauy (Addgene plasmid # 154066 ; http://n2t.net/addgene:154066 ; RRID:Addgene_154066) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173