Skip to main content

EC71167
(Plasmid #154066)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154066 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EC47822
  • Backbone manufacturer
    ENSA
  • Backbone size w/o insert (bp) 4376
  • Total vector size (bp) 8790
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZmUBI::lox-mCHERRY-lox-T35S-eGFP-TAct
  • Alt name
    Lox bound mCHERRY
  • Species
    A. thaliana (mustard weed), Synthetic; Zea mays
  • Insert Size (bp)
    4414
  • Mutation
    All BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes
  • Promoter Zea mays Ubiquitin Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GCACATACAAATGGACGAAC
  • 3′ sequencing primer CTGCCTGTATCGAGTGGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EC71167 was a gift from Cristobal Uauy (Addgene plasmid # 154066 ; http://n2t.net/addgene:154066 ; RRID:Addgene_154066)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173