Skip to main content

EC71171
(Plasmid #154069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154069 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH41308
  • Backbone manufacturer
    Sylvestre Marillonnet/ TSL SynBio
  • Backbone size w/o insert (bp) 2221
  • Total vector size (bp) 3477
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRE_U5intron
  • Alt name
    Cre Recombinase with the U5 intron
  • Species
    Synthetic
  • Insert Size (bp)
    1256
  • Mutation
    All BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes. Cre Recombinase was modified by the inclusion of the Arabidopsis thaliana ribonucleoprotein U5 intron at 254bp.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer GCCAGCAACGCGGCCTTTTTAC
  • 3′ sequencing primer CCACTTCGTGGTCTCAAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EC71171 was a gift from Cristobal Uauy (Addgene plasmid # 154069 ; http://n2t.net/addgene:154069 ; RRID:Addgene_154069)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173