EC71171
(Plasmid
#154069)
-
PurposeLevel 0 Golden Gate vector, CRE with U5 intron at 254bp, in pICH41308 backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH41308
-
Backbone manufacturerSylvestre Marillonnet/ TSL SynBio
- Backbone size w/o insert (bp) 2221
- Total vector size (bp) 3477
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRE_U5intron
-
Alt nameCre Recombinase with the U5 intron
-
SpeciesSynthetic
-
Insert Size (bp)1256
-
MutationAll BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes. Cre Recombinase was modified by the inclusion of the Arabidopsis thaliana ribonucleoprotein U5 intron at 254bp.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GCCAGCAACGCGGCCTTTTTAC
- 3′ sequencing primer CCACTTCGTGGTCTCAAAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EC71171 was a gift from Cristobal Uauy (Addgene plasmid # 154069 ; http://n2t.net/addgene:154069 ; RRID:Addgene_154069) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173