Skip to main content

pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5-IMPROVED
(Plasmid #154088)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154088 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pINDUCER-21
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ligand Dependent Nuclear Receptor Corepressor, HOXA9, HOXA5
  • Alt name
    LCOR, HOXA9, HOXA5 separated by a 2A peptide
  • Species
    H. sapiens (human)
  • Entrez Gene
    LCOR (a.k.a. C10orf12, MLR2)
  • Entrez Gene
    HOXA9 (a.k.a. ABD-B, HOX1, HOX1.7, HOX1G)
  • Entrez Gene
    HOXA5 (a.k.a. HOX1, HOX1.3, HOX1C)
  • Promoter Tet on

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TCTGGGACGTCGTATGGGTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5-IMPROVED was a gift from George Daley (Addgene plasmid # 154088 ; http://n2t.net/addgene:154088 ; RRID:Addgene_154088)
  • For your References section:

    Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439