scFv-GCN4-DNMT3a-DNMT3l
(Plasmid
#154140)
-
PurposeExpresses the scFv-GCN4-DNMT3a-DNMT3l fusion protein (more details are shown in the vectro map) for targeted DNA methylation. Should be used in a combination with the dCas9-SunTag systems.
-
Depositing Lab
-
Depositing OrganizationUniversitaet Stuttgart
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 154140-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 154140-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAmpR-Ori
- Backbone size w/o insert (bp) 2663
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3537
-
GenBank IDNM_007872.4 NM_019448.4
- Promoter SFFV
-
Tags
/ Fusion Proteins
- HA
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCGAGTCAGTGAGCGAG
- 3′ sequencing primer CCCACTAGGTAATTGGCAGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 154140-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 154140-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
scFv-GCN4-DNMT3a-DNMT3l was a gift from Albert Jeltsch (Addgene plasmid # 154140 ; http://n2t.net/addgene:154140 ; RRID:Addgene_154140) -
For your References section:
Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101
Map uploaded by the depositor.
