scFv-GCN4-DNMT3a(R887E)-DNMT3l
(Plasmid
#154141)
-
PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAmpR-Ori
- Backbone size w/o insert (bp) 2663
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)3537
-
MutationR887E
-
GenBank IDNM_007872.4 NM_019448.4
- Promoter SFFV
-
Tags
/ Fusion Proteins
- HA
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCGAGTCAGTGAGCGAG
- 3′ sequencing primer CCCACTAGGTAATTGGCAGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
scFv-GCN4-DNMT3a(R887E)-DNMT3l was a gift from Albert Jeltsch (Addgene plasmid # 154141 ; http://n2t.net/addgene:154141 ; RRID:Addgene_154141) -
For your References section:
Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101