Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

dCas9-10xSunTag-P2A-tagBFP
(Plasmid #174141)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174141 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AmpR-Ori
  • Backbone size w/o insert (bp) 5706
  • Total vector size (bp) 10032
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9, 10xSunTag, tagBFP
  • Species
    Synthetic; Streptococcus pyogenes
  • Insert Size (bp)
    5958
  • GenBank ID
  • Promoter SV40
  • Tags / Fusion Proteins
    • HA
    • tagBFP (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGCGAGTCAGTGAGCGAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Shorter version of the original plasmid, in which a 4.5-kb fragment in the vector backbone was deleted

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9-10xSunTag-P2A-tagBFP was a gift from Albert Jeltsch (Addgene plasmid # 174141 ; http://n2t.net/addgene:174141 ; RRID:Addgene_174141)
  • For your References section:

    Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101