pCMV(WT)-mouse-full-length-CHMP3-HA
(Plasmid
#154175)
-
Purposeexpresses mouse CHMP3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV(WT)
-
Backbone manufacturerEvNO00601609
- Backbone size w/o insert (bp) 5422
- Total vector size (bp) 6124
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHMP3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)702
-
Entrez GeneChmp3 (a.k.a. 25.1, 4921505F14Rik, 9130011K15Rik, CGI-49, D6Ertd286e, NEDF, Vps24)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDiane Downhour, Nels Elde laboratory, University of Utah
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV(WT)-mouse-full-length-CHMP3-HA was a gift from Wesley Sundquist (Addgene plasmid # 154175 ; http://n2t.net/addgene:154175 ; RRID:Addgene_154175) -
For your References section:
RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582