Skip to main content

pCAG-OSF-PP-squirrel-monkey-CHMP3
(Plasmid #154182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154182 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-OSF-PP
  • Backbone manufacturer
    Addgene 154247
  • Backbone size w/o insert (bp) 5016
  • Total vector size (bp) 5675
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHMP3
  • Species
    S. sciureus (squirrel monkey)
  • Insert Size (bp)
    696
  • Promoter CAG
  • Tags / Fusion Proteins
    • Strep-Tag II (N terminal on insert)
    • Strep-Tag II (N terminal on insert)
    • FLAG (N terminal on insert)
    • preScission site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TGTCCCCATAATTTTTGGCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-OSF-PP-squirrel-monkey-CHMP3 was a gift from Wesley Sundquist (Addgene plasmid # 154182 ; http://n2t.net/addgene:154182 ; RRID:Addgene_154182)
  • For your References section:

    RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582