Skip to main content

CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
(Plasmid #154197)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154197 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRL
  • Vector type
    Mammalian Expression, Lentiviral ; CaTCH barcode activation
  • Selectable markers
    Neomycin (select with G418) ; Thy1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA-BC2-A, sgRNA-BC2-C
  • gRNA/shRNA sequence
    GTAGGAAACTTCAAATACCA, GAGGTCTGGAATATCAGCC
  • Species
    Synthetic
  • Promoter hU6 and mU6

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Johannes Zuber at Institute of Molecular Pathology, Vienna

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C was a gift from Anna Obenauf (Addgene plasmid # 154197 ; http://n2t.net/addgene:154197 ; RRID:Addgene_154197)
  • For your References section:

    Isolating live cell clones from barcoded populations using CRISPRa-inducible reporters. Umkehrer C, Holstein F, Formenti L, Jude J, Froussios K, Neumann T, Cronin SM, Haas L, Lipp JJ, Burkard TR, Fellner M, Wiesner T, Zuber J, Obenauf AC. Nat Biotechnol. 2020 Jul 27. pii: 10.1038/s41587-020-0614-0. doi: 10.1038/s41587-020-0614-0. 10.1038/s41587-020-0614-0 PubMed 32719478