Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
(Plasmid #154197)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154197 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRL
  • Vector type
    Mammalian Expression, Lentiviral ; CaTCH barcode activation
  • Selectable markers
    Neomycin (select with G418) ; Thy1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA-BC2-A, sgRNA-BC2-C
  • gRNA/shRNA sequence
    GTAGGAAACTTCAAATACCA, GAGGTCTGGAATATCAGCC
  • Species
    Synthetic
  • Promoter hU6 and mU6

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Johannes Zuber at Institute of Molecular Pathology, Vienna

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C was a gift from Anna Obenauf (Addgene plasmid # 154197 ; http://n2t.net/addgene:154197 ; RRID:Addgene_154197)
  • For your References section:

    Isolating live cell clones from barcoded populations using CRISPRa-inducible reporters. Umkehrer C, Holstein F, Formenti L, Jude J, Froussios K, Neumann T, Cronin SM, Haas L, Lipp JJ, Burkard TR, Fellner M, Wiesner T, Zuber J, Obenauf AC. Nat Biotechnol. 2020 Jul 27. pii: 10.1038/s41587-020-0614-0. doi: 10.1038/s41587-020-0614-0. 10.1038/s41587-020-0614-0 PubMed 32719478