TPI in pCW57_tTA_Blast
(Plasmid
#154209)
-
PurposeDox-off lentivirus construct all-in-one vector, with Blast resistance, for expression of TPI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTPI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)750
-
Entrez GeneTPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
- Promoter TRE repeats (dox off)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGCAGAGCTCGTTTAGTGAACC
- 3′ sequencing primer CGAACGGACGTGAAGAATGTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TPI in pCW57_tTA_Blast was a gift from David Sabatini (Addgene plasmid # 154209 ; http://n2t.net/addgene:154209 ; RRID:Addgene_154209) -
For your References section:
Dihydroxyacetone phosphate signals glucose availability to mTORC1. Orozco JM, Krawczyk PA, Scaria SM, Cangelosi AL, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nat Metab. 2020 Sep;2(9):893-901. doi: 10.1038/s42255-020-0250-5. Epub 2020 Jul 27. 10.1038/s42255-020-0250-5 PubMed 32719541