Skip to main content

TPI in pCW57_tTA_Blast
(Plasmid #154209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TPI1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    750
  • Entrez Gene
    TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
  • Promoter TRE repeats (dox off)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGCAGAGCTCGTTTAGTGAACC
  • 3′ sequencing primer CGAACGGACGTGAAGAATGTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TPI in pCW57_tTA_Blast was a gift from David Sabatini (Addgene plasmid # 154209 ; http://n2t.net/addgene:154209 ; RRID:Addgene_154209)
  • For your References section:

    Dihydroxyacetone phosphate signals glucose availability to mTORC1. Orozco JM, Krawczyk PA, Scaria SM, Cangelosi AL, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nat Metab. 2020 Sep;2(9):893-901. doi: 10.1038/s42255-020-0250-5. Epub 2020 Jul 27. 10.1038/s42255-020-0250-5 PubMed 32719541