This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59700)


Item Catalog # Description Quantity Price (USD)
Plasmid 59700 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Lentiviral Prep 59700-LV Virus (1 mL at titer > 1x10⁶ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 8765
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Tag / Fusion Protein
    • 2A (C terminal on insert)

Gene/Insert 2

  • Gene/Insert name
  • Tag / Fusion Protein
    • 2A (C terminal on insert)

Gene/Insert 3

  • Gene/Insert name

Resource Information

Depositor Comments

This lentiviral vector can be used as a standard for titering experiments when trying to compare vectors with different selection markers. It can also be used to determine if selection conditions with blasticidin or puromycin are using too high or too low a concentration of drug. If there are surviving cells that are EGFP-negative, then drug concentration is too low. If there are dying cells that express EGFP, then drug concentration is likely too high.

Information for Lentiviral Prep (Catalog # 59700-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from pRosetta (#59700). In addition to the viral particles, you will also receive purified pRosetta plasmid DNA.

Lentiviral particles carrying a GFP tag and both puromycin and blasticidin resistance.


  • Volume 1 mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin, Blasticidin


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 59700-LV. 96 hours later GFP-positive cells were counted. You can view GFP expression in pRosetta-transduced cells here or at the image section at the top of this page. Read our fluorescence titering assay protocol here.
  • Colony formation: A549 cells were transduced with serial dilutions of 59700-LV and treated with blasticidin or puromycin. Blasticidin or puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting the puromycin-resistance gene and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: Puro-F2 CTCGGCTTCACCGTCACC
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRosetta was a gift from John Doench & David Root (Addgene plasmid # 59700 ; ; RRID:Addgene_59700)

    For viral preps, please replace (Addgene plasmid # 59700) in the above sentence with: (Addgene viral prep # 59700-LV)