pDYU1G/γ-tubulin-mEGFP
(Plasmid
#154301)
-
PurposeExpresses γ-tubulin–mEGFP from actin15 promoter in Dictyostelium discoideum
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDYU1G
-
Backbone manufacturerTomo Kondo
-
Vector typeDictyostelium Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameγ-tubulin
-
SpeciesDictyostelium discoideum
-
GenBank ID
- Promoter actin15
-
Tag
/ Fusion Protein
- mEGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGAGATCTATGCCAAGAGAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDYU1G/γ-tubulin-mEGFP was a gift from Shigehiko Yumura (Addgene plasmid # 154301 ; http://n2t.net/addgene:154301 ; RRID:Addgene_154301) -
For your References section:
An improved molecular tool for screening bacterial colonies using GFP expression enhanced by a Dictyostelium sequence. Kondo T, Yumura S. Biotechniques. 2020 Feb;68(2):91-95. doi: 10.2144/btn-2019-0127. Epub 2019 Dec 11. 10.2144/btn-2019-0127 PubMed 31825246