Skip to main content

pDYU1G/mRuby3–histone H1; γ-tubulin-mEGFP
(Plasmid #154303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154303 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDYU1G
  • Backbone manufacturer
    Tomo Kondo
  • Backbone size w/o insert (bp) 7697
  • Total vector size (bp) 11632
  • Vector type
    Dictyostelium Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    histone H1
  • Species
    Dictyostelium discoideum
  • Promoter actin15
  • Tag / Fusion Protein
    • mRuby3 (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    γ-tubulin
  • Species
    Dictyostelium discoideum
  • Promoter actin15
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGGTCTAGAGATCTATGCCAAGAGAAATAATTACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYU1G/mRuby3–histone H1; γ-tubulin-mEGFP was a gift from Shigehiko Yumura (Addgene plasmid # 154303 ; http://n2t.net/addgene:154303 ; RRID:Addgene_154303)
  • For your References section:

    An improved molecular tool for screening bacterial colonies using GFP expression enhanced by a Dictyostelium sequence. Kondo T, Yumura S. Biotechniques. 2020 Feb;68(2):91-95. doi: 10.2144/btn-2019-0127. Epub 2019 Dec 11. 10.2144/btn-2019-0127 PubMed 31825246