pSM-dCas9::Ap
              
              
                (Plasmid
                
                #154307)
              
            
            
            
          - 
            Purpose(Empty Backbone) Shuttle vector for expression dCas9, mobilization cluster, expresses the tracrRNA and a CRISPR array designed for the easy cloning of new spacers.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSM-dCas9
 - Backbone size (bp) 9496
 - 
              Vector typeBacterial Expression, CRISPR, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Cloning Information
- 5′ sequencing primer ATGGATTACAAGGACCACGACGGGGA
 - 3′ sequencing primer TACGATGTCCCTGACTACGCCTCATGA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pSM-dCas9::Ap was a gift from I-Son Ng (Addgene plasmid # 154307 ; http://n2t.net/addgene:154307 ; RRID:Addgene_154307) - 
                
For your References section:
CRISPRi-mediated Programming Essential Gene can as a Direct Enzymatic Performance Evaluation & Determination (DEPEND) System. Tan SI, Yu PJ, Ng IS. Biotechnol Bioeng. 2020 May 27. doi: 10.1002/bit.27443. 10.1002/bit.27443 PubMed 32458463