pJW1827
(Plasmid
#154323)
-
PurposeMulti-cassette for SapTrap
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR221
- Backbone size w/o insert (bp) 2360
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name30aa linker::mScarlet-I
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)942
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1827 was a gift from Jordan Ward (Addgene plasmid # 154323 ; http://n2t.net/addgene:154323 ; RRID:Addgene_154323) -
For your References section:
An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541