pJW1850
              
              
                (Plasmid
                
                #154328)
              
            
            
            
          - 
            PurposesgRNA Target Vector for CRISPR
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepJW1838
 - Backbone size w/o insert (bp) 3500
 - 
              Vector typeWorm Expression, CRISPR
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namettTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
 - 
                    SpeciesC. elegans (nematode), Synthetic
 - 
                  Insert Size (bp)20
 - 
                  MutationF+E mutations in sgRNA
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
 - 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg) (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Cloning by SapTrap
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pJW1850 was a gift from Jordan Ward (Addgene plasmid # 154328 ; http://n2t.net/addgene:154328 ; RRID:Addgene_154328) - 
                
For your References section:
An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541