pSUI-SynP-CANTsg
(Plasmid
#154343)
-
PurposeExpression of the sgRNA targeting to the E. coli can gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSUI-SynP-sfGFP
- Total vector size (bp) 3578
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCANT sgRNA
-
gRNA/shRNA sequenceTCAGGTCAGTGTGAATGACC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ACTCTGCGACATCGTATAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUI-SynP-CANTsg was a gift from I-Son Ng (Addgene plasmid # 154343 ; http://n2t.net/addgene:154343 ; RRID:Addgene_154343) -
For your References section:
CRISPRi-mediated Programming Essential Gene can as a Direct Enzymatic Performance Evaluation & Determination (DEPEND) System. Tan SI, Yu PJ, Ng IS. Biotechnol Bioeng. 2020 May 27. doi: 10.1002/bit.27443. 10.1002/bit.27443 PubMed 32458463