Skip to main content

pNAD1
(Plasmid #154347)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154347 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 4789
  • Total vector size (bp) 6952
  • Modifications to backbone
    The Zeocin resistance (ShBle) gene with the Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter and the terminators of alpha tubulin gene and clp protease proteolytic subunit of Nannochloropsis was cloned onto the pUC19 backbone via Gibson assembly along with the homologous recombination flanks for deletion of Nitrate reductase gene.
  • Vector type
    Bacterial Expression ; microalgae
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ShBle
  • Alt name
    ZeoR
  • Species
    Streptoalloteichus hindustanus
  • Insert Size (bp)
    375
  • Mutation
    none
  • GenBank ID
    txid2017
  • Promoter Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTGATGGCCGAGTTAAGG
  • 3′ sequencing primer AAGTCGTCCTCCACGAAGTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ShBle was obtained from addgene #62863

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNAD1 was a gift from John van der Oost (Addgene plasmid # 154347 ; http://n2t.net/addgene:154347 ; RRID:Addgene_154347)
  • For your References section:

    CRISPR-Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1. Naduthodi MIS, Mohanraju P, Sudfeld C, D'Adamo S, Barbosa MJ, van der Oost J. Biotechnol Biofuels. 2019 Mar 25;12:66. doi: 10.1186/s13068-019-1401-3. eCollection 2019. 10.1186/s13068-019-1401-3 PubMed 30962821