pNAD1
(Plasmid
#154347)
-
PurposepUC19 backbone with editing template for homologous recombination mediated deletion of Nitrate reductase gene of N. oceanica and selection based on zeocin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 4789
- Total vector size (bp) 6952
-
Modifications to backboneThe Zeocin resistance (ShBle) gene with the Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter and the terminators of alpha tubulin gene and clp protease proteolytic subunit of Nannochloropsis was cloned onto the pUC19 backbone via Gibson assembly along with the homologous recombination flanks for deletion of Nitrate reductase gene.
-
Vector typeBacterial Expression ; microalgae
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShBle
-
Alt nameZeoR
-
SpeciesStreptoalloteichus hindustanus
-
Insert Size (bp)375
-
Mutationnone
-
GenBank IDtxid2017
- Promoter Violaxanthin Chlorophyll a Binding Protein Precursor (VCP) promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTGATGGCCGAGTTAAGG
- 3′ sequencing primer AAGTCGTCCTCCACGAAGTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byShBle was obtained from addgene #62863
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNAD1 was a gift from John van der Oost (Addgene plasmid # 154347 ; http://n2t.net/addgene:154347 ; RRID:Addgene_154347) -
For your References section:
CRISPR-Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1. Naduthodi MIS, Mohanraju P, Sudfeld C, D'Adamo S, Barbosa MJ, van der Oost J. Biotechnol Biofuels. 2019 Mar 25;12:66. doi: 10.1186/s13068-019-1401-3. eCollection 2019. 10.1186/s13068-019-1401-3 PubMed 30962821