KRAS-A146T
(Plasmid
#154426)
-
PurposeA146T Kras with Flag tag inserted into N-terminal domain between 6Xhis tag and TEV cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDNA2.0
-
Backbone manufacturerATUM
- Backbone size w/o insert (bp) 3939
- Total vector size (bp) 4500
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKRAS
-
Alt nameKirsten ras oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)507
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter T5
-
Tags
/ Fusion Proteins
- 6xHis-tag
- TEV protease cleavage sequence
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAATTGTGAGCGCTCACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KRAS-A146T was a gift from Kenneth Westover (Addgene plasmid # 154426 ; http://n2t.net/addgene:154426 ; RRID:Addgene_154426) -
For your References section:
Tissue-Specific Oncogenic Activity of KRAS(A146T). Poulin EJ, Bera AK, Lu J, Lin YJ, Strasser SD, Paulo JA, Huang TQ, Morales C, Yan W, Cook J, Nowak JA, Brubaker DK, Joughin BA, Johnson CW, DeStefanis RA, Ghazi PC, Gondi S, Wales TE, Iacob RE, Bogdanova L, Gierut JJ, Li Y, Engen JR, Perez-Mancera PA, Braun BS, Gygi SP, Lauffenburger DA, Westover KD, Haigis KM. Cancer Discov. 2019 Jun;9(6):738-755. doi: 10.1158/2159-8290.CD-18-1220. Epub 2019 Apr 5. 10.1158/2159-8290.CD-18-1220 PubMed 30952657