-
PurposeExpression of SARS-CoV-2 nsp12
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac
- Backbone size w/o insert (bp) 6610
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 nsp12
-
SpeciesSevere acute respiratory syndrome coronavirus 2
-
Insert Size (bp)2802
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter Polyhedron
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAC TAT GGA AAA CGC CCA GAA AGG
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac-His-MBP-SCov2-nsp12 was a gift from Patrick Cramer (Addgene plasmid # 154759 ; http://n2t.net/addgene:154759 ; RRID:Addgene_154759) -
For your References section:
Structure of replicating SARS-CoV-2 polymerase. Hillen HS, Kokic G, Farnung L, Dienemann C, Tegunov D, Cramer P. Nature. 2020 May 21. pii: 10.1038/s41586-020-2368-8. doi: 10.1038/s41586-020-2368-8. 10.1038/s41586-020-2368-8 PubMed 32438371