pRG646_lexO-HO_LexA-TF_LEU2MX
(Plasmid #154815)

• Purpose: Inducible expression of HO endonuclease in S. cerevisiae
• Depositing Lab: Lorraine Symington
• Publication: Gnugge et al Nucleic Acids Res. 2020 Oct 14. pii: 5923424. doi: 10.1093/nar/gkaa833.

Backbone

• Vector backbone: pRG205MX
• Backbone manufacturer: Addgene plasmid # 64535
• Backbone size w/o insert (bp): 5193
• Total vector size (bp): 10531
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: HO endonuclease
• Alt name: YDL227C
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2489
• Entrez Gene: HO (a.k.a. YDL227C)
• Promoter: lexO_4-CYC1_core
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: KpnI (non-unique) (not destroyed)
• 5′ sequencing primer: T7 TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: LexA-ER-B112
• Species: Synthetic
• Insert Size (bp): 2926
• Promoter: ACT1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (non-unique) (not destroyed)
• 3′ cloning site: KpnI (non-unique) (not destroyed)
• 5′ sequencing primer: ACT1 Promoter Forward TATTTCTCTGTCACCCGGCC
• 3′ sequencing primer: M13 Reverse CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pRG646.gbk
• A portion of this plasmid was derived from a plasmid made by: LexA TF from FRP880 (Addgene plasmid # 58437).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Linearize plasmid with AscI for integration into the yeast genome. See Gnuegge et al., 2016 (https://pubmed.ncbi.nlm.nih.gov/26647923/) for details.