Skip to main content

pRG713_lexO-HO_LexA-TF_URA3MX
(Plasmid #154821)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154821 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRG206MX
  • Backbone manufacturer
    Addgene plasmid # 64536
  • Backbone size w/o insert (bp) 4434
  • Total vector size (bp) 9772
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HO endonuclease
  • Alt name
    YDL227C
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2489
  • Entrez Gene
    HO (a.k.a. YDL227C)
  • Promoter lexO_4-CYC1_core
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (non-unique) (not destroyed)
  • 5′ sequencing primer T7 TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    LexA-ER-B112
  • Species
    Synthetic
  • Insert Size (bp)
    2926
  • Promoter ACT1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (non-unique) (not destroyed)
  • 3′ cloning site KpnI (non-unique) (not destroyed)
  • 5′ sequencing primer ACT1 Promoter Forward TATTTCTCTGTCACCCGGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    LexA TF from FRP880 (Addgene plasmid # 58437).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Linearize plasmid with AscI for integration into the yeast genome. See Gnuegge et al., 2016 (https://pubmed.ncbi.nlm.nih.gov/26647923/) for details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRG713_lexO-HO_LexA-TF_URA3MX was a gift from Lorraine Symington (Addgene plasmid # 154821 ; http://n2t.net/addgene:154821 ; RRID:Addgene_154821)
  • For your References section:

    Efficient DNA double-strand break formation at single or multiple defined sites in the Saccharomyces cerevisiae genome. Gnugge R, Symington LS. Nucleic Acids Res. 2020 Oct 14. pii: 5923424. doi: 10.1093/nar/gkaa833. 10.1093/nar/gkaa833 PubMed 33053188