pRSFDuet1-sgRNA(siteA)
(Plasmid
#154831)
-
PurposesgRNA for CRISPR/Cas9-mediated targeted integration into genomic site A in CHO cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRSFDuet1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3801
-
Modifications to backboneAmplified for USER cloning
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA(siteA)
-
gRNA/shRNA sequenceGACATAGTAACCCCAAAGAG
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a sgRNA plasmid for CRISPR/Cas9-mediated targeted integration in Chinese hamster ovary (CHO) cells. The target site A is located on chromosome 2, in intron 2 of Polk in CHO genome.
The genomic site A was initially described in:
Pristovšek N et al., 2019 "Systematic Evaluation of Site-Specific Recombinant Gene Expression for Programmable Mammalian Cell Engineering". DOI: 10.1021/acssynbio.8b00453
Protocol for CRISPR/Cas9-mediated targeted integration in CHO cells:
Sergeeva D et al. 2019 "CRISPR/Cas9 as a Genome Editing Tool for Targeted Gene Integration in CHO Cells". DOI: 10.1007/978-1-4939-9170-9_13
The plasmid was assembled by USER cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1-sgRNA(siteA) was a gift from Lise Marie Grav (Addgene plasmid # 154831 ; http://n2t.net/addgene:154831 ; RRID:Addgene_154831) -
For your References section:
Multi-copy targeted integration for accelerated development of high-producing CHO cells. Sergeeva D, Lee GM, Nielsen LK, Grav LM. ACS Synth Biol. 2020 Aug 24. doi: 10.1021/acssynbio.0c00322. 10.1021/acssynbio.0c00322 PubMed 32835482