Skip to main content

pRSFDuet1-sgRNA(siteA)
(Plasmid #154831)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154831 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSFDuet1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3801
  • Modifications to backbone
    Amplified for USER cloning
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA(siteA)
  • gRNA/shRNA sequence
    GACATAGTAACCCCAAAGAG
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a sgRNA plasmid for CRISPR/Cas9-mediated targeted integration in Chinese hamster ovary (CHO) cells. The target site A is located on chromosome 2, in intron 2 of Polk in CHO genome.

The genomic site A was initially described in:
Pristovšek N et al., 2019 "Systematic Evaluation of Site-Specific Recombinant Gene Expression for Programmable Mammalian Cell Engineering". DOI: 10.1021/acssynbio.8b00453

Protocol for CRISPR/Cas9-mediated targeted integration in CHO cells:
Sergeeva D et al. 2019 "CRISPR/Cas9 as a Genome Editing Tool for Targeted Gene Integration in CHO Cells". DOI: 10.1007/978-1-4939-9170-9_13

The plasmid was assembled by USER cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet1-sgRNA(siteA) was a gift from Lise Marie Grav (Addgene plasmid # 154831 ; http://n2t.net/addgene:154831 ; RRID:Addgene_154831)
  • For your References section:

    Multi-copy targeted integration for accelerated development of high-producing CHO cells. Sergeeva D, Lee GM, Nielsen LK, Grav LM. ACS Synth Biol. 2020 Aug 24. doi: 10.1021/acssynbio.0c00322. 10.1021/acssynbio.0c00322 PubMed 32835482