Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pASPIre1
(Plasmid #154842)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154842 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSEVA291
  • Total vector size (bp) 7576
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    add glucose to avoid premature recombination by Bxb1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bxb1 controlled by rhamnose-inducible promoter; attB/attP-flanked discriminator containing mCherry; rhaRS operon
  • Species
    Synthetic
  • Insert Size (bp)
    4741
  • Promoter Prha

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGGACCCCTGGATTCTCAC
  • 3′ sequencing primer TACTCAGGAGAGCGTTCACC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pASPIre1 was a gift from Markus Jeschek (Addgene plasmid # 154842 ; http://n2t.net/addgene:154842 ; RRID:Addgene_154842)
  • For your References section:

    Large-scale DNA-based phenotypic recording and deep learning enable highly accurate sequence-function mapping. Hollerer S, Papaxanthos L, Gumpinger AC, Fischer K, Beisel C, Borgwardt K, Benenson Y, Jeschek M. Nat Commun. 2020 Jul 15;11(1):3551. doi: 10.1038/s41467-020-17222-4. 10.1038/s41467-020-17222-4 PubMed 32669542