LIC4B-His-TEV-TAK1-TAB1
(Plasmid
#154874)
-
PurposeInsect cell optimized TAK1-TAB1 construct used to solve structure and deposit PDB ID: 4O91
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLIC4B
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5748
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTAK1-TAB1
-
SpeciesH. sapiens (human)
-
MutationCodon optimized
-
Entrez GeneTAB1 (a.k.a. 3'-Tab1, MAP3K7IP1)
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- LIC TEV His
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGGAAGAAAGCGAAAGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LIC4B-His-TEV-TAK1-TAB1 was a gift from Kenneth Westover (Addgene plasmid # 154874 ; http://n2t.net/addgene:154874 ; RRID:Addgene_154874) -
For your References section:
Discovery of type II inhibitors of TGFbeta-activated kinase 1 (TAK1) and mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2). Tan L, Nomanbhoy T, Gurbani D, Patricelli M, Hunter J, Geng J, Herhaus L, Zhang J, Pauls E, Ham Y, Choi HG, Xie T, Deng X, Buhrlage SJ, Sim T, Cohen P, Sapkota G, Westover KD, Gray NS. J Med Chem. 2015 Jan 8;58(1):183-96. doi: 10.1021/jm500480k. Epub 2014 Jul 30. 10.1021/jm500480k PubMed 25075558