pBMN-AS-YY1
(Plasmid
#154943)
-
PurposeKnocking down of human YY1 through shRNA and amiRNA targeting YY1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBMN(CMV-copGFP-Puro)
-
Backbone manufacturerConstructed from pGreenPuro (SBI) by Magnus Essand Lab
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshRNA and amiRNA against YY1
-
gRNA/shRNA sequenceshRNA targeting "GCCTCTCCTTTGTATATTATT " and amiRNA targeting "GGGAGCAGAAGCAGGTGCAGAT" of human YY1 mRNA
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneYY1 (a.k.a. DELTA, GADEVS, INO80S, NF-E1, UCRBP, YIN-YANG-1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMN-AS-YY1 was a gift from Claes Wadelius (Addgene plasmid # 154943 ; http://n2t.net/addgene:154943 ; RRID:Addgene_154943) -
For your References section:
Multifaceted regulation of hepatic lipid metabolism by YY1. Pan G, Diamanti K, Cavalli M, Lara Gutierrez A, Komorowski J, Wadelius C. Life Sci Alliance. 2021 Jun 7;4(7). pii: 4/7/e202000928. doi: 10.26508/lsa.202000928. Print 2021 Jul. 10.26508/lsa.202000928 PubMed 34099540