Skip to main content

pBMN-AS-YY1
(Plasmid #154943)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154943 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBMN(CMV-copGFP-Puro)
  • Backbone manufacturer
    Constructed from pGreenPuro (SBI) by Magnus Essand Lab
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shRNA and amiRNA against YY1
  • gRNA/shRNA sequence
    shRNA targeting "GCCTCTCCTTTGTATATTATT " and amiRNA targeting "GGGAGCAGAAGCAGGTGCAGAT" of human YY1 mRNA
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    YY1 (a.k.a. DELTA, GADEVS, INO80S, NF-E1, UCRBP, YIN-YANG-1)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN-AS-YY1 was a gift from Claes Wadelius (Addgene plasmid # 154943 ; http://n2t.net/addgene:154943 ; RRID:Addgene_154943)
  • For your References section:

    Multifaceted regulation of hepatic lipid metabolism by YY1. Pan G, Diamanti K, Cavalli M, Lara Gutierrez A, Komorowski J, Wadelius C. Life Sci Alliance. 2021 Jun 7;4(7). pii: 4/7/e202000928. doi: 10.26508/lsa.202000928. Print 2021 Jul. 10.26508/lsa.202000928 PubMed 34099540