Skip to main content

pLCHKO_HPRT1_exon3_1_Lb
(Plasmid #155053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155053 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLCHKO
  • Backbone size w/o insert (bp) 7481
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    (hg)RNA for deletion of HPRT1 exon 3
  • gRNA/shRNA sequence
    CTTATGAAACATGAGGGCAAgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctaatttctactaagtgtagatTAACATATTCACTAGTACTTTAC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    150
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuAI (destroyed during cloning)
  • 3′ cloning site BfuAI (destroyed during cloning)
  • 5′ sequencing primer actatcatatgcttaccgtaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

U6-driven hgRNA cassette encoded on anti-sense strand

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLCHKO_HPRT1_exon3_1_Lb was a gift from Benjamin Blencowe & Jason Moffat (Addgene plasmid # 155053 ; http://n2t.net/addgene:155053 ; RRID:Addgene_155053)
  • For your References section:

    Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Gonatopoulos-Pournatzis T, Aregger M, Brown KR, Farhangmehr S, Braunschweig U, Ward HN, Ha KCH, Weiss A, Billmann M, Durbic T, Myers CL, Blencowe BJ, Moffat J. Nat Biotechnol. 2020 May;38(5):638-648. doi: 10.1038/s41587-020-0437-z. Epub 2020 Mar 16. 10.1038/s41587-020-0437-z PubMed 32249828