Skip to main content

pGTag-P2A-QFGal4-SV40pA
(Plasmid #155127)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155127 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pK
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 3310
  • Total vector size (bp) 4390
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P2A-QFGal4
  • Species
    S. cerevisiae (budding yeast); Neurospora crassa
  • Insert Size (bp)
    1080
  • GenBank ID
    855828 3875756

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GCATGGATGTTTTCCCAGTC
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pGTag series vectors were described in PMID: 32412410. pGTag-P2A-QFGal4-SV40 was modified from pGTag-eGFP-SV40 (Plasmid #117813).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGTag-P2A-QFGal4-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155127 ; http://n2t.net/addgene:155127 ; RRID:Addgene_155127)
  • For your References section:

    An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972