pTrc99a-NoSS-TolC
(Plasmid
#155179)
-
PurposeExpresses signal sequence-less TolC as inclusion bodies
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrc99a
- Backbone size w/o insert (bp) 4176
- Total vector size (bp) 5592
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTolC
-
Insert Size (bp)1416
-
Mutationdeleted residues 1-20, residue 21 mutated to Met (start codon)
-
GenBank IDNP_417507.2
-
Entrez GenetolC (a.k.a. b3035, ECK3026, colE1-i, mtcB, mukA, refI, toc, weeA)
- Promoter trc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRajeev Misra - Arizona State University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/692251 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrc99a-NoSS-TolC was a gift from Joanna Slusky (Addgene plasmid # 155179 ; http://n2t.net/addgene:155179 ; RRID:Addgene_155179) -
For your References section:
Colicin E1 opens its hinge to plug TolC. Budiardjo SJ, Stevens JJ, Calkins AL, Ikujuni AP, Wimalasena VK, Firlar E, Case DA, Biteen JS, Kaelber JT, Slusky JSG. Elife. 2022 Feb 24;11. pii: 73297. doi: 10.7554/eLife.73297. 10.7554/eLife.73297 PubMed 35199644