Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTrc99a-NoSS-TolC
(Plasmid #155179)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155179 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTrc99a
  • Backbone size w/o insert (bp) 4176
  • Total vector size (bp) 5592
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TolC
  • Insert Size (bp)
    1416
  • Mutation
    deleted residues 1-20, residue 21 mutated to Met (start codon)
  • GenBank ID
    NP_417507.2
  • Entrez Gene
    tolC (a.k.a. b3035, ECK3026, colE1-i, mtcB, mukA, refI, toc, weeA)
  • Promoter trc

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rajeev Misra - Arizona State University

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/692251 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrc99a-NoSS-TolC was a gift from Joanna Slusky (Addgene plasmid # 155179 ; http://n2t.net/addgene:155179 ; RRID:Addgene_155179)
  • For your References section:

    Colicin E1 opens its hinge to plug TolC. Budiardjo SJ, Stevens JJ, Calkins AL, Ikujuni AP, Wimalasena VK, Firlar E, Case DA, Biteen JS, Kaelber JT, Slusky JSG. Elife. 2022 Feb 24;11. pii: 73297. doi: 10.7554/eLife.73297. 10.7554/eLife.73297 PubMed 35199644