Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

3xHA-TurboID pRetrox
(Plasmid #155203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155203 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRetroX-Tight-Puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6541
  • Total vector size (bp) 7603
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3xHA-TurboID
  • Alt name
    TurboID
  • Species
    Synthetic
  • Insert Size (bp)
    1062
  • Promoter tight TRE promotor
  • Tag / Fusion Protein
    • 3xHA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NaeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAGAAGCTGGATAACTTC
  • 3′ sequencing primer CAGAGGCCACTTGTGTAGCGCCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid 107171

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xHA-TurboID pRetrox was a gift from Kyle Roux (Addgene plasmid # 155203 ; http://n2t.net/addgene:155203 ; RRID:Addgene_155203)
  • For your References section:

    Comparative Application of BioID and TurboID for Protein-Proximity Biotinylation. May DG, Scott KL, Campos AR, Roux KJ. Cells. 2020 Apr 25;9(5). pii: cells9051070. doi: 10.3390/cells9051070. 10.3390/cells9051070 PubMed 32344865