Skip to main content

bNS2B47NS3
(Plasmid #155320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155320 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNIC
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4779
  • Total vector size (bp) 6806
  • Modifications to backbone
    NA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Co expression of DENV4 NS3 full length protein with 47 peptides from NS2B cofactor
  • Alt name
    NS2B47NS3
  • Species
    Dengue virus 4
  • Mutation
    WT
  • GenBank ID
    JF262783 G11337
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTTCTGGCTCGCTGAAACGCCGCTC
  • 3′ sequencing primer gcgcttaatgcgccgctacagggcgcgt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ordered from genescript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bNS2B47NS3 was a gift from Dahai Luo (Addgene plasmid # 155320 ; http://n2t.net/addgene:155320 ; RRID:Addgene_155320)
  • For your References section:

    Crystal structures of full length DENV4 NS2B-NS3 reveal the dynamic interaction between NS2B and NS3. Phoo WW, El Sahili A, Zhang Z, Chen MW, Liew CW, Lescar J, Vasudevan SG, Luo D. Antiviral Res. 2020 Oct;182:104900. doi: 10.1016/j.antiviral.2020.104900. Epub 2020 Aug 5. 10.1016/j.antiviral.2020.104900 PubMed 32763315