pNBA001
(Plasmid
#155323)
-
PurposeBinary vector for expression of PULSE-controlled EFR-GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneXpre2-S
-
Vector typeSynthetic Biology ; Eukaryotic Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe operator repetitions can be lost after bacterial propagation. It is recommended to grow the bacteria at 30°C and sequence the repeats after new DNA preparations.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLB_(etr)8-(C120)5-PhCMVmin-EFR-GFP-T35S_RB
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ctgcctgtatcgagtggtga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNBA001 was a gift from Matias Zurbriggen (Addgene plasmid # 155323 ; http://n2t.net/addgene:155323 ; RRID:Addgene_155323) -
For your References section:
Optogenetic control of gene expression in plants in the presence of ambient white light. Ochoa-Fernandez R, Abel NB, Wieland FG, Schlegel J, Koch LA, Miller JB, Engesser R, Giuriani G, Brandl SM, Timmer J, Weber W, Ott T, Simon R, Zurbriggen MD. Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29. 10.1038/s41592-020-0868-y PubMed 32601426