PPAPDC2
(Plasmid
#155836)
-
PurposeFor use in RBP tethering screen
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneE2.pEF5-DEST-FL-V5-MCP
- Backbone size w/o insert (bp) 7357
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPAPDC2
-
Alt nameAccession: BC038108.2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)888
-
Mutationnone
-
Entrez GenePLPP6 (a.k.a. PDP1, PPAPDC2, PSDP, bA6J24.6)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- V5-MCP (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer gctcgagtctagagggc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNASU Plasmid Repository Center for Personalized Diagnostics Biodesign Institute
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PPAPDC2 was a gift from Eugene Yeo (Addgene plasmid # 155836 ; http://n2t.net/addgene:155836 ; RRID:Addgene_155836) -
For your References section:
Large-scale tethered function assays identify factors that regulate mRNA stability and translation. Luo EC, Nathanson JL, Tan FE, Schwartz JL, Schmok JC, Shankar A, Markmiller S, Yee BA, Sathe S, Pratt GA, Scaletta DB, Ha Y, Hill DE, Aigner S, Yeo GW. Nat Struct Mol Biol. 2020 Oct;27(10):989-1000. doi: 10.1038/s41594-020-0477-6. Epub 2020 Aug 17. 10.1038/s41594-020-0477-6 PubMed 32807991