pLenti-PGK-RAP2A-WT-neo
(Plasmid
#156177)
-
PurposeLentiviral vector for expression of RAP2A-WT, with neomycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti PGK Neo DEST (w531-1)
-
Backbone manufacturerCampeau lab (addgene #19067)
- Backbone size w/o insert (bp) 9778
- Total vector size (bp) 8738
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAP2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)540
-
Mutationwild type form
-
GenBank IDNM_021033
-
Entrez GeneRAP2A (a.k.a. K-REV, KREV, RAP2, RbBP-30)
- Promoter human PGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer PGK_F (GTGTTCCGCATTCTGCAAG)
- 3′ sequencing primer WPRE_R (CATAGCGTAAAAGGAGCAACA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRap2A cDNA was originally obtained as synthetic DNA fragment.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RAP2A-WT DNA fragment was cloned into pENTR DTOPO and transferred by Gateway cloning into Desination vector. bioRxiv 10.1101/792077
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-RAP2A-WT-neo was a gift from Roland Friedel (Addgene plasmid # 156177 ; http://n2t.net/addgene:156177 ; RRID:Addgene_156177) -
For your References section:
Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052