Skip to main content

pLentiCMVblast_SLC38A2_wt
(Plasmid #156180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156180 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti CMV Blast DEST
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 9216
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC38A2
  • Alt name
    SNAT2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1521
  • Mutation
    Silent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG
  • GenBank ID
    BC040342.1
  • Entrez Gene
    SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
  • Promoter CMV

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Silent mutations are as follows: aat ctg agc aat gcg att gtg ggc agt --> AAC TTG TCC AAC GCA ATC GTT GGT TCT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCMVblast_SLC38A2_wt was a gift from Alec Kimmelman (Addgene plasmid # 156180 ; http://n2t.net/addgene:156180 ; RRID:Addgene_156180)
  • For your References section:

    Selective alanine transporter utilization creates a targetable metabolic niche in pancreatic cancer. Parker SJ, Amendola CR, Hollinshead KER, Yu Q, Yamamoto K, Encarnacion-Rosado J, Rose RE, LaRue MM, Sohn ASW, Biancur DE, Paulo JA, Gygi SP, Jones DR, Wang H, Philips MR, Bar-Sagi D, Mancias JD, Kimmelman AC. Cancer Discov. 2020 Apr 27. pii: 2159-8290.CD-19-0959. doi: 10.1158/2159-8290.CD-19-0959. 10.1158/2159-8290.CD-19-0959 PubMed 32341021