Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDEST-V2-ORF
(Plasmid #73636)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73636 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 6987
  • Modifications to backbone
    Insertion of Gateway compatible recombination site. Insertion of Venus fluorescent protein fragment (V2) upstream and in frame of Gateway compatible recombination site.
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Zeocin
  • Tag / Fusion Protein
    • Venus fragment 2 (V2) (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Venus fragment was a kind gift from Prof. Stephen Michnick (University of Montreal). Plasmid built by Darren N. Saunders, Adrian Wan and Joseph Lau.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-V2-ORF was a gift from Darren Saunders (Addgene plasmid # 73636 ; http://n2t.net/addgene:73636 ; RRID:Addgene_73636)
  • For your References section:

    Bimolecular complementation affinity purification (BiCAP) reveals dimer-specific protein interactions for ERBB2 dimers. Croucher DR, Iconomou M, Hastings JF, Kennedy SP, Han JZ, Shearer RF, McKenna J, Wan A, Lau J, Aparicio S, Saunders DN. Sci Signal. 2016 Jul 12;9(436):ra69. doi: 10.1126/scisignal.aaf0793. 10.1126/scisignal.aaf0793 PubMed 27405979