Skip to main content

inhibin-DsRed
(Plasmid #156184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDsRed2-1
  • Backbone manufacturer
    Clontech Laboratories Inc.
  • Backbone size w/o insert (bp) 4107
  • Total vector size (bp) 6836
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    rainbow trout inhibin α promoter
  • Species
    Oncorhynchus mykiss
  • Insert Size (bp)
    2113
  • Promoter inhibin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindⅢ (destroyed during cloning)
  • 3′ cloning site BamHⅠ (not destroyed)
  • 5′ sequencing primer aagtatttggtgaacaaca
  • 3′ sequencing primer ccagtctgcatggttcagat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rainbow trout β actin 3'UTR
  • Species
    Oncorhynchus mykiss
  • Insert Size (bp)
    652
  • GenBank ID
    AJ438158

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotⅠ (destroyed during cloning)
  • 3′ cloning site NotⅠ (destroyed during cloning)
  • 5′ sequencing primer cacctgttcctgtagcggcctaaacagactgtacc
  • 3′ sequencing primer tatgatctagtgtcgcggcctttattgggagttta
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    inhibin-DsRed was a gift from Goro Yoshizaki (Addgene plasmid # 156184 ; http://n2t.net/addgene:156184 ; RRID:Addgene_156184)
  • For your References section:

    Production of functional eggs and sperm from in vitro-expanded type A spermatogonia in rainbow trout. Iwasaki-Takahashi Y, Shikina S, Watanabe M, Banba A, Yagisawa M, Takahashi K, Fujihara R, Okabe T, Valdez DM Jr, Yamauchi A, Yoshizaki G. Commun Biol. 2020 Jun 15;3(1):308. doi: 10.1038/s42003-020-1025-y. 10.1038/s42003-020-1025-y PubMed 32541813
Commonly requested with: