inhibin-DsRed
(Plasmid
#156184)
-
PurposeExpression plasmid for production of transgenic rainbow trout strain carrying the DsRed gene under control of the inhibin α promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDsRed2-1
-
Backbone manufacturerClontech Laboratories Inc.
- Backbone size w/o insert (bp) 4107
- Total vector size (bp) 6836
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namerainbow trout inhibin α promoter
-
SpeciesOncorhynchus mykiss
-
Insert Size (bp)2113
- Promoter inhibin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindⅢ (destroyed during cloning)
- 3′ cloning site BamHⅠ (not destroyed)
- 5′ sequencing primer aagtatttggtgaacaaca
- 3′ sequencing primer ccagtctgcatggttcagat (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerainbow trout β actin 3'UTR
-
SpeciesOncorhynchus mykiss
-
Insert Size (bp)652
-
GenBank IDAJ438158
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotⅠ (destroyed during cloning)
- 3′ cloning site NotⅠ (destroyed during cloning)
- 5′ sequencing primer cacctgttcctgtagcggcctaaacagactgtacc
- 3′ sequencing primer tatgatctagtgtcgcggcctttattgggagttta (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
inhibin-DsRed was a gift from Goro Yoshizaki (Addgene plasmid # 156184 ; http://n2t.net/addgene:156184 ; RRID:Addgene_156184) -
For your References section:
Production of functional eggs and sperm from in vitro-expanded type A spermatogonia in rainbow trout. Iwasaki-Takahashi Y, Shikina S, Watanabe M, Banba A, Yagisawa M, Takahashi K, Fujihara R, Okabe T, Valdez DM Jr, Yamauchi A, Yoshizaki G. Commun Biol. 2020 Jun 15;3(1):308. doi: 10.1038/s42003-020-1025-y. 10.1038/s42003-020-1025-y PubMed 32541813