Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTYF-super-mfSERT-1.9k-Venus-WPRE
(Plasmid #156394)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 156394 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTYF
  • Backbone size w/o insert (bp) 7469
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Venus
  • Insert Size (bp)
    720

Gene/Insert 2

  • Gene/Insert name
    Gal4p65
  • Insert Size (bp)
    1062

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified a common point of recombination in the promoter region. Requesting scientists should screen multiple colonies by PCR using GCGTCTCTGAATGCCAGCAC and GACTGAGCTGGACAACCATG and selecting an appropriately sized clone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTYF-super-mfSERT-1.9k-Venus-WPRE was a gift from Shuji Kaneko (Addgene plasmid # 156394 ; http://n2t.net/addgene:156394 ; RRID:Addgene_156394)
  • For your References section:

    Identification of neuron-type specific promoters in monkey genome and their functional validation in mice. Nagai Y, Nishitani N, Yasuda M, Ueda Y, Fukui Y, Andoh C, Shirakawa H, Nakagawa T, Inoue KI, Nagayasu K, Kasparov S, Nakamura K, Kaneko S. Biochem Biophys Res Commun. 2019 Oct 22;518(4):619-624. doi: 10.1016/j.bbrc.2019.08.101. Epub 2019 Aug 23. 10.1016/j.bbrc.2019.08.101 PubMed 31451217