pTYF-super-mfSERT-1.9k-Venus-WPRE
(Plasmid
#156394)
-
PurposeExpresses Venus under SERT gene promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTYF
- Backbone size w/o insert (bp) 7469
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVenus
-
Insert Size (bp)720
Gene/Insert 2
-
Gene/Insert nameGal4p65
-
Insert Size (bp)1062
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC identified a common point of recombination in the promoter region. Requesting scientists should screen multiple colonies by PCR using GCGTCTCTGAATGCCAGCAC and GACTGAGCTGGACAACCATG and selecting an appropriately sized clone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYF-super-mfSERT-1.9k-Venus-WPRE was a gift from Shuji Kaneko (Addgene plasmid # 156394 ; http://n2t.net/addgene:156394 ; RRID:Addgene_156394) -
For your References section:
Identification of neuron-type specific promoters in monkey genome and their functional validation in mice. Nagai Y, Nishitani N, Yasuda M, Ueda Y, Fukui Y, Andoh C, Shirakawa H, Nakagawa T, Inoue KI, Nagayasu K, Kasparov S, Nakamura K, Kaneko S. Biochem Biophys Res Commun. 2019 Oct 22;518(4):619-624. doi: 10.1016/j.bbrc.2019.08.101. Epub 2019 Aug 23. 10.1016/j.bbrc.2019.08.101 PubMed 31451217