pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
(Plasmid
#156431)
-
PurposeTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAD21, Halotag
-
Alt nameSCC1
-
SpeciesM. musculus (mouse)
-
Mutationnone
-
Entrez GeneRad21 (a.k.a. SCC, SCC1, mHR21, mKIAA0078)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting was a gift from Elphege Nora (Addgene plasmid # 156431 ; http://n2t.net/addgene:156431 ; RRID:Addgene_156431) -
For your References section:
Molecular basis of CTCF binding polarity in genome folding. Nora EP, Caccianini L, Fudenberg G, So K, Kameswaran V, Nagle A, Uebersohn A, Hajj B, Saux AL, Coulon A, Mirny LA, Pollard KS, Dahan M, Bruneau BG. Nat Commun. 2020 Nov 5;11(1):5612. doi: 10.1038/s41467-020-19283-x. 10.1038/s41467-020-19283-x PubMed 33154377