Molecular basis of CTCF binding polarity in genome folding.
Nora EP, Caccianini L, Fudenberg G, So K, Kameswaran V, Nagle A, Uebersohn A, Hajj B, Saux AL, Coulon A, Mirny LA, Pollard KS, Dahan M, Bruneau BG
Nat Commun. 2020 Nov 5;11(1):5612. doi: 10.1038/s41467-020-19283-x. PubMed Article
Nora EP, Caccianini L, Fudenberg G, So K, Kameswaran V, Nagle A, Uebersohn A, Hajj B, Saux AL, Coulon A, Mirny LA, Pollard KS, Dahan M, Bruneau BG
Nat Commun. 2020 Nov 5;11(1):5612. doi: 10.1038/s41467-020-19283-x. PubMed Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
156429 | pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE | Vector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection. |
156430 | pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE | Vector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection. |
156431 | pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting | Targeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTG |
156432 | pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor | Vector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection. |
156433 | pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct | Targeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTG |
156434 | pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE | Vector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. |
156435 | pEN716 - pCAGGS-eGFP-3Xnls-bpA | For transient expression of nuclear eGFP in mammalian cells |
156436 | pEN765 -pCAGGS-3XFLAG-mKate2-(human)PDS5B-bpA | For transient expression of human PDS5B tagged with mKate2 |
156438 | pKS004 - pCAGGS-3XFLAG-CTCF-eGFP | For transient expression of mouse CTCF tagged with eGFP |
156439 | pKS016 - pCAGGS-3XFLAG-mKate2-Pds5a-bpA | For transient expression of mouse PDS5A tagged with mKate2 |
156440 | pKS021 - pCAGGS-3XFLAG-mKate2-SA1-bpA | For transient expression of mouse SA1 (= STAG1 or SCC3A) tagged with mKate2 |
156441 | pKS022 - pCAGGS-3XFLAG-mKate2-SA2-bpA | For transient expression of mouse SA2 (STAG2 or SCC3B) tagged with mKate2 |
156442 | pKS023 - pCAGGS-3XFLAG-mKate2-Pds5b-bpA | For transient expression of mouse PDS5B tagged with mKate2 |
156443 | pKS031 - pCAGGS-3XFLAG-BORIS-eGFP-bpA | For transient expression of mouse BORIS (CTCFL) tagged with eGFP |
156445 | pKS035 - pCAGGS-3XFLAG-Rad21-mKate2-bpA | For transient expression of mouse RAD21 (SCC1) tagged with mKate2 |
156447 | pKS037 - pCAGGS-3XFLAG-Smc3-mKate2-bpA | For transient expression of mouse SMC3 tagged with mKate2 |
156448 | pKS070 - pCAGGS-3XFLAG-(human)CTCF-eGFP | For transient expression of human CTCF tagged with eGFP |
156449 | pKS071 - pCAGGS-3XFLAG-mKate2-(human)PDS5A-bpA | For transient expression of human PDS5A tagged with mKate2 |
156450 | pX330-EN1082_Rad21_STOP | For transient expression of Cas9 and sgRNA targeting mouse RAD21 stop codon |
156451 | pX330-EN1680_Sororin-Cterm | For transient expression of Cas9 and sgRNA targeting mouse Cdc5a (SORORIN) stop codon |